Skip to main content

Lab 5 DNA Sequences

The Following Sequences are intended for Lab 5: Bioinformatics. You may download the sequences using the links below or Contact Us to request that they be sent over email.

Lab 5 – Bioinformatics I: Sanger Sequence Analysis

Lab 5 – Bioinformatics II: NCBI Sequence Taxonomy and BLAST Searching

Wolbachia Sequence for BLAST Search (.fasta file)

GTTGCAGCAATGGTAGACTCAACGGTAGCAATAACTGCAGGACCTAGAGGAAAAACAGTAGGGATTAAT

AAGCCCTATGGAGCACCAGAAATTACAAAAGATGGTTATAAGGTGATGAAGGGTATCAAGCCTGAAAAA

CCATTAAACGCTGCGATAGCAAGCATCTTTGCACAGAGTTGTTCTCAATGTAACGATAAAGTTGGTGATG

GTACAACAACGTGCTCAATACTAACTAGCAACATGATAATGGAAGCTTCAAAATCAATTGCTGCTGGAAA

CGATCGTGTTGGTATTAAAAACGGAATACAGAAGGCAAAAGATGTAATATTAAAGGAAATTGCGTCAATG

TCTCGTACAATTTCTCTAGAGAAAATAGACGAAGTGGCACAAGTTGCAATAATCTCTGCAAATGGTGATA

AGGATATAGGTAACAGTATCGCTGATTCCGTGAAAAAAGTTGGAAAAGAGGGTGTAATAACTGTTGAAG

AGAGTAAAGGTTCAAAAGAGTTAGAAGTTGAGCTGACTACTGGCATGCAATTTGATCGCGGTTATCTCTC

TCCGTATTTTATTACAAATAATGAAAAAATGATCGTGGAGCTTGATAATCCTTATCTATTAATTACAGAGA

AAAAATTAAATATTATTCAACCTTTACTTCCTATTCTTGAAGCTATTGTTAAATCTGGTAAACCTTTGGTTA

TTATTGCAGAGGATATCGAAGGTGAAGCATTAAGCACTTTAGTTATCAATAAATTGCGTGGTGGTTTAAA

AGTTGCTGCAGTAAAAGCTCCAGGTTTTGGTGACAGAAGAAAGGAGATGCTCGAAGACATAGCAACTTTA

ACTGGTGCTAAGTACGTCATAAAAGATGAACTT